Home

Walk around Hello Weekdays mouse beta actin primer Stun Rough sleep Description

β-Actin (13E5) Rabbit mAb | Cell Signaling Technology
β-Actin (13E5) Rabbit mAb | Cell Signaling Technology

Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG

Actb Mouse qPCR Primer Pair (NM_007393) – MP200232 | OriGene
Actb Mouse qPCR Primer Pair (NM_007393) – MP200232 | OriGene

β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax
β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax

MonoRab™ Beta Actin Antibody, mAb, Rabbit - GenScript
MonoRab™ Beta Actin Antibody, mAb, Rabbit - GenScript

View Image
View Image

Identification of the full-length β-actin sequence and expression profiles in the tree shrew (Tupaia belangeri)
Identification of the full-length β-actin sequence and expression profiles in the tree shrew (Tupaia belangeri)

PCR primer sequences used for mouse genotyping and qPCR. | Download Table
PCR primer sequences used for mouse genotyping and qPCR. | Download Table

Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met Rat Runx1 Rat Actin Mouse A
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met Rat Runx1 Rat Actin Mouse A

Primers used for PCRof mouse and human integrin subunits. | Download Scientific Diagram
Primers used for PCRof mouse and human integrin subunits. | Download Scientific Diagram

β-actin dependent chromatin remodeling mediates compartment level changes in 3D genome architecture | Nature Communications
β-actin dependent chromatin remodeling mediates compartment level changes in 3D genome architecture | Nature Communications

Sequences of the primers used in real-time PCR of mouse tissue. | Download Table
Sequences of the primers used in real-time PCR of mouse tissue. | Download Table

Generation and Functional Characterization of Mice with a Disrupted Glutathione S-Transferase, Theta 1 Gene | Drug Metabolism & Disposition
Generation and Functional Characterization of Mice with a Disrupted Glutathione S-Transferase, Theta 1 Gene | Drug Metabolism & Disposition

Reference genes for gene expression studies in the mouse heart | Scientific Reports
Reference genes for gene expression studies in the mouse heart | Scientific Reports

Involvement of MicroRNAs in Regulation of Osteoblastic Differentiation in Mouse Induced Pluripotent Stem Cells | PLOS ONE
Involvement of MicroRNAs in Regulation of Osteoblastic Differentiation in Mouse Induced Pluripotent Stem Cells | PLOS ONE

Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library
Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library

Silencing of the Mouse H-rev107 Gene Encoding a Class II Tumor Suppressor by CpG Methylation* - Journal of Biological Chemistry
Silencing of the Mouse H-rev107 Gene Encoding a Class II Tumor Suppressor by CpG Methylation* - Journal of Biological Chemistry

THE™ beta Actin Antibody [HRP], mAb, Mouse - GenScript
THE™ beta Actin Antibody [HRP], mAb, Mouse - GenScript

Table S1 Sequences of primers used for quantitative RT-PCR analysis Primer Sequences (5' to 3') Mouse IFN-β Forward AGGGCGG
Table S1 Sequences of primers used for quantitative RT-PCR analysis Primer Sequences (5' to 3') Mouse IFN-β Forward AGGGCGG

Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG

Figure 2 from PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification | Semantic Scholar
Figure 2 from PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification | Semantic Scholar

Mouse ACTB (Actin, Beta) Endogenous Control (FAM™ Dye/MGB probe, Non-Primer Limited)
Mouse ACTB (Actin, Beta) Endogenous Control (FAM™ Dye/MGB probe, Non-Primer Limited)

Design and Testing of β-Actin Primers for RT-PCR that Do Not Co-amplify Processed Pseudogenes
Design and Testing of β-Actin Primers for RT-PCR that Do Not Co-amplify Processed Pseudogenes