MonoRab™ Beta Actin Antibody, mAb, Rabbit - GenScript
ACTB, Human actin, beta, Real Time PCR Primer Set | RealTimePrimers | Biomol.com
Time for rethinking the different β‐actin transgenic mouse models? - Vanslembrouck - 2020 - Cytoskeleton - Wiley Online Library
Selective measurement of α smooth muscle actin: why β-actin can not be used as a housekeeping gene when tissue fibrosis occurs | BMC Molecular Biology | Full Text
Housekeeping Gene Selection Advisory: Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) and β-Actin Are Targets of miR-644a | PLOS ONE
Primer Pair for Beta Actin (ACTB) | PGB340Mi01 | Homo sapiens (Human), Mus musculus (Mouse), Rattus norvegicus (Rat) CLOUD-CLONE CORP.(CCC)
Frontiers | β-Actin: Not a Suitable Internal Control of Hepatic Fibrosis Caused by Schistosoma japonicum
A rapid real-time qRT-PCR assay for ovine ß-actin mRNA
Forward (F) and Reverse (R) Primer Sequences of β-actin and hTERT Used... | Download Scientific Diagram
Primers for amplification of GRP58, HPRT, and β-actin genes | Download Table
Primer Sequences for Hb and β-Actin cDNA and Resulting Fragment Lengths. | Download Table
Beta-actin Loading Control | OriGene
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
Primer sequences of C4A, C4B, CTins and Beta-actin qPCR runs. | Download Table
PCR primers and primer sequences used to amplify EF1A, EF2, and b-actin... | Download Table
β-Actin and GAPDH housekeeping gene expression in asthmatic airways is variable and not suitable for normalising mRNA levels | Thorax
The Early-Onset Myocardial Infarction Associated PHACTR1 Gene Regulates Skeletal and Cardiac Alpha-Actin Gene Expression | PLOS ONE
TaqMan™ Gene Expression Assay, VIC primer-limited
PGB340Mi01 | Primer Pair for Beta Actin (ACTB) | Homo sapiens (Human), Mus musculus (Mouse), Rattus norvegicus (Rat) USCN(Wuhan USCN Business Co., Ltd. )
SimpleChIP® Human β-Actin Promoter Primers | Cell Signaling Technology
Human ACTB (Beta Actin) Endogenous Control (FAM™/MGB probe, non-primer limited)
